colonsyre colonsyre

27-10-2021
Mathematics

contestada

1/4÷3/8 i need helpp tyy

Respuesta :

1405603 1405603

27-10-2021

8/12 is your answer hope i could help

Answer Link

Аноним Аноним

27-10-2021

i believe it's 1/96ㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤ

Answer Link

Otras preguntas

how to find acceleration with force and mass calculator

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

The swimming pool is open when the high temperature is higher than 20^\circ\text{C}20∘C20, degrees, start text, C, end text. Lainey tried to swim on Monday and

the group of cells that use chemicals to recycle elements in the blood are calleda.musclesb.glandsc.hormones d.oxygen

PLZ HELP! 50 POINTS!!!! Which device is used to change a signal into a code?Group of answer choicesan encoderan antennaa wave

What organelle is instrumental in holding the instructions to make proteins and controlling most of the cell functions? O nucleus O ribosome O endoplasmic retic

A store gets a large shipment of fruit in which 90% of the fruit is edible and 10% are spoiled. If six pieces of fruit are selected at random from the shipment,

After sitting in a refrigerator for a while, a turkey at a temperature of 34^\circ34 ∘ F is placed on the counter and slowly warms closer to room temperature

According to the graph, approximately how much of the us population used the internet in 2006? less than 20% about 40% about 70% more than 80%.

ABC is an isosceles right triangle in which has a slope of -1 and mABC = 90Â°. ABC is dilated by a scale factor of 1. 8 with the origin as the center of dilatio