jennyGx
jennyGx
29-07-2017
Mathematics
contestada
HELP PLEASE............
Respuesta :
koziadam
koziadam
29-07-2017
Well the graph with the highest slope means it is more expensive.
The slope of the red apples = 2x.
We need the slope of the green apples.
*solving*
The slope of the green apples = 3/2x
Because 2 > 3/2, red apples are more expensive
Answer Link
VER TODAS LAS RESPUESTAS ( 27+ )
Otras preguntas
You are the manager of an apartment complex with 50 units. When you set rent at $800/month, all apartments are rented. As you increase rent by $25/month, one fe
Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed f
How does the author create and maintain tension during the scene at the cornucopia The hunger games
16. Jorge plans to paint a bedroom wall that is shaped like a trapezoid. The bottom edge of the wall is 22.5 feet long, and the top edge of the wall is 9.5 feet
A system using an automated work cell controlled by electronic signals from a common centralized computer facility is called: an adaptive control system. roboti
Marnie just finished setting herself up at a cozy spot at the airport. Her laptop is ready, phone within reach, and her papers are organized, but now, she's hu
Which is an example of using an open-ended question to uncover a problem? O a) "Do you have a problem you'd like addressed today?" b) "Is there a problem? C) "W
2 Air enters the compressor of a cold air-standard Brayton cycle at 100 kPa, 300 K, with a mass flow rate of 6 kg/s. The compressor pressure ratio is 10, and th
Fiona y sus amigas fueron a una tienda de batidos. Pidieron tres batidos de fresa y dos batidos de proteínas por un total de $ 24,00. La semana pasada pidieron
2x^2-3x+2=x√(3x^2-2)
